The biom file format: Version 1.0¶
The biom format is based on JSON to provide the overall structure for the format. JSON is a widely supported format with native parsers available within many programming languages.
Required top-level fields:
id : <string or null> a field that can be used to id a table (or null)
format : <string> The name and version of the current biom format
format_url : <url> A string with a static URL providing format details
type : <string> Table type (a controlled vocabulary)
Acceptable values:
"OTU table"
"Pathway table"
"Function table"
"Ortholog table"
"Gene table"
"Metabolite table"
"Taxon table"
generated_by : <string> Package and revision that built the table
date : <datetime> Date the table was built (ISO 8601 format)
rows : <list of objects> An ORDERED list of obj describing the rows
(explained in detail below)
columns : <list of objects> An ORDERED list of obj describing the columns
(explained in detail below)
matrix_type : <string> Type of matrix data representation (a controlled vocabulary)
Acceptable values:
"sparse" : only non-zero values are specified
"dense" : every element must be specified
matrix_element_type : Value type in matrix (a controlled vocabulary)
Acceptable values:
"int" : integer
"float" : floating point
"unicode" : unicode string
shape : <list of ints>, the number of rows and number of columns in data
data : <list of lists>, counts of observations by sample
if matrix_type is "sparse", [[row, column, value],
[row, column, value],
...]
if matrix_type is "dense", [[value, value, value, ...],
[value, value, value, ...],
...]
Optional top-level fields:
comment : <string> A free text field containing any information that you
feel is relevant (or just feel like sharing)
The rows value is an ORDERED list of objects where each object corresponds to a single row in the matrix. Each object can currently store arbitrary keys, although this might become restricted based on table type. Each object must provide, at the minimum:
id : <string> an arbitrary UNIQUE identifier
metadata : <an object or null> A object containing key, value metadata pairs
The columns value is an ORDERED list of objects where each object corresponds to a single column in the matrix. Each object can currently store arbitrary keys, although this might become restricted based on table type. Each object must provide, at the minimum:
id : <string> an arbitrary UNIQUE identifier
metadata : <an object or null> A object containing key, value metadata pairs
Example biom files¶
Below are examples of minimal and rich biom files in both sparse and dense formats. To decide which of these you should generate for new data types, see the section on Tips and FAQs regarding the BIOM file format.
Minimal sparse OTU table¶
{
"id":null,
"format": "1.0.0",
"format_url": "http://biom-format.org",
"type": "OTU table",
"generated_by": "QIIME revision 1.4.0-dev",
"date": "2011-12-19T19:00:00",
"rows":[
{"id":"GG_OTU_1", "metadata":null},
{"id":"GG_OTU_2", "metadata":null},
{"id":"GG_OTU_3", "metadata":null},
{"id":"GG_OTU_4", "metadata":null},
{"id":"GG_OTU_5", "metadata":null}
],
"columns": [
{"id":"Sample1", "metadata":null},
{"id":"Sample2", "metadata":null},
{"id":"Sample3", "metadata":null},
{"id":"Sample4", "metadata":null},
{"id":"Sample5", "metadata":null},
{"id":"Sample6", "metadata":null}
],
"matrix_type": "sparse",
"matrix_element_type": "int",
"shape": [5, 6],
"data":[[0,2,1],
[1,0,5],
[1,1,1],
[1,3,2],
[1,4,3],
[1,5,1],
[2,2,1],
[2,3,4],
[2,4,2],
[3,0,2],
[3,1,1],
[3,2,1],
[3,5,1],
[4,1,1],
[4,2,1]
]
}
Minimal dense OTU table¶
{
"id":null,
"format": "Biological Observation Matrix 0.9.1-dev",
"format_url": "http://biom-format.org/documentation/format_versions/biom-1.0.html",
"type": "OTU table",
"generated_by": "QIIME revision 1.4.0-dev",
"date": "2011-12-19T19:00:00",
"rows":[
{"id":"GG_OTU_1", "metadata":null},
{"id":"GG_OTU_2", "metadata":null},
{"id":"GG_OTU_3", "metadata":null},
{"id":"GG_OTU_4", "metadata":null},
{"id":"GG_OTU_5", "metadata":null}
],
"columns": [
{"id":"Sample1", "metadata":null},
{"id":"Sample2", "metadata":null},
{"id":"Sample3", "metadata":null},
{"id":"Sample4", "metadata":null},
{"id":"Sample5", "metadata":null},
{"id":"Sample6", "metadata":null}
],
"matrix_type": "dense",
"matrix_element_type": "int",
"shape": [5,6],
"data": [[0,0,1,0,0,0],
[5,1,0,2,3,1],
[0,0,1,4,2,0],
[2,1,1,0,0,1],
[0,1,1,0,0,0]]
}
Rich sparse OTU table¶
{
"id":null,
"format": "Biological Observation Matrix 0.9.1-dev",
"format_url": "http://biom-format.org/documentation/format_versions/biom-1.0.html",
"type": "OTU table",
"generated_by": "QIIME revision 1.4.0-dev",
"date": "2011-12-19T19:00:00",
"rows":[
{"id":"GG_OTU_1", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}},
{"id":"GG_OTU_2", "metadata":{"taxonomy":["k__Bacteria", "p__Cyanobacteria", "c__Nostocophycideae", "o__Nostocales", "f__Nostocaceae", "g__Dolichospermum", "s__"]}},
{"id":"GG_OTU_3", "metadata":{"taxonomy":["k__Archaea", "p__Euryarchaeota", "c__Methanomicrobia", "o__Methanosarcinales", "f__Methanosarcinaceae", "g__Methanosarcina", "s__"]}},
{"id":"GG_OTU_4", "metadata":{"taxonomy":["k__Bacteria", "p__Firmicutes", "c__Clostridia", "o__Halanaerobiales", "f__Halanaerobiaceae", "g__Halanaerobium", "s__Halanaerobiumsaccharolyticum"]}},
{"id":"GG_OTU_5", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}}
],
"columns":[
{"id":"Sample1", "metadata":{
"BarcodeSequence":"CGCTTATCGAGA",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample2", "metadata":{
"BarcodeSequence":"CATACCAGTAGC",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample3", "metadata":{
"BarcodeSequence":"CTCTCTACCTGT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample4", "metadata":{
"BarcodeSequence":"CTCTCGGCCTGT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}},
{"id":"Sample5", "metadata":{
"BarcodeSequence":"CTCTCTACCAAT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}},
{"id":"Sample6", "metadata":{
"BarcodeSequence":"CTAACTACCAAT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}}
],
"matrix_type": "sparse",
"matrix_element_type": "int",
"shape": [5, 6],
"data":[[0,2,1],
[1,0,5],
[1,1,1],
[1,3,2],
[1,4,3],
[1,5,1],
[2,2,1],
[2,3,4],
[2,5,2],
[3,0,2],
[3,1,1],
[3,2,1],
[3,5,1],
[4,1,1],
[4,2,1]
]
}
Rich dense OTU table¶
{
"id":null,
"format": "Biological Observation Matrix 0.9.1-dev",
"format_url": "http://biom-format.org/documentation/format_versions/biom-1.0.html",
"type": "OTU table",
"generated_by": "QIIME revision 1.4.0-dev",
"date": "2011-12-19T19:00:00",
"rows":[
{"id":"GG_OTU_1", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}},
{"id":"GG_OTU_2", "metadata":{"taxonomy":["k__Bacteria", "p__Cyanobacteria", "c__Nostocophycideae", "o__Nostocales", "f__Nostocaceae", "g__Dolichospermum", "s__"]}},
{"id":"GG_OTU_3", "metadata":{"taxonomy":["k__Archaea", "p__Euryarchaeota", "c__Methanomicrobia", "o__Methanosarcinales", "f__Methanosarcinaceae", "g__Methanosarcina", "s__"]}},
{"id":"GG_OTU_4", "metadata":{"taxonomy":["k__Bacteria", "p__Firmicutes", "c__Clostridia", "o__Halanaerobiales", "f__Halanaerobiaceae", "g__Halanaerobium", "s__Halanaerobiumsaccharolyticum"]}},
{"id":"GG_OTU_5", "metadata":{"taxonomy":["k__Bacteria", "p__Proteobacteria", "c__Gammaproteobacteria", "o__Enterobacteriales", "f__Enterobacteriaceae", "g__Escherichia", "s__"]}}
],
"columns":[
{"id":"Sample1", "metadata":{
"BarcodeSequence":"CGCTTATCGAGA",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample2", "metadata":{
"BarcodeSequence":"CATACCAGTAGC",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample3", "metadata":{
"BarcodeSequence":"CTCTCTACCTGT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample4", "metadata":{
"BarcodeSequence":"CTCTCGGCCTGT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}},
{"id":"Sample5", "metadata":{
"BarcodeSequence":"CTCTCTACCAAT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}},
{"id":"Sample6", "metadata":{
"BarcodeSequence":"CTAACTACCAAT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}}
],
"matrix_type": "dense",
"matrix_element_type": "int",
"shape": [5,6],
"data": [[0,0,1,0,0,0],
[5,1,0,2,3,1],
[0,0,1,4,2,0],
[2,1,1,0,0,1],
[0,1,1,0,0,0]]
}